Writing Command Statements for Defining Groups of Taxa and for Annotating Taxa with Meta Data

The MEGA format allows you to assign group definitions and other meta data to the taxa A taxon is the individual unit whose evolutionary relationship is being investigated. Depending on the study, “taxa” may refer to species, populations, individuals, or sequences within an individual. in sequence alignment files as well as to distance data files. Meta data is written in a set of curly brackets following the taxa A taxon is the individual unit whose evolutionary relationship is being investigated. Depending on the study, “taxa” may refer to species, populations, individuals, or sequences within an individual. name. The meta data can be attached to the taxa A taxon is the individual unit whose evolutionary relationship is being investigated. Depending on the study, “taxa” may refer to species, populations, individuals, or sequences within an individual. name using an underscore or it can just be appended to the sequence name. It is important to note that there should be no spaces between the taxa A taxon is the individual unit whose evolutionary relationship is being investigated. Depending on the study, “taxa” may refer to species, populations, individuals, or sequences within an individual. name and meta data command. (Note that groups of taxa A taxon is the individual unit whose evolutionary relationship is being investigated. Depending on the study, “taxa” may refer to species, populations, individuals, or sequences within an individual. can also be defined interactively through a dialog box). MEGA supports the following meta data commands (order does not matter):

    group, species, population, continent, country, city, year, month, day, time

Meta data commands must adhere to the following rules:

• All fields are optional.

• Fields are defined after taxa names and in curly braces that follow an underscore (_) character.

• Fields are defined as field=value pairs.

• Fields definitions are separated by the pipe (|) character.

• Year and day fields must be integers.

• Month can be defined as an integer (1-12), the full month name (e.g. September) or a 3 letter abbreviation (e.g. sep)

• Values for string-based fields (population, group, species, continent, country, city) must follow the same rules as taxa names.

• Time must be formatted as hh:mm:ss.

The following example shows meta data commands for three pathogen sequences:

#pathogen_sample_20200520_Paris_{population=european|group=symptomatic|species=homo_sapiens|continent=Europe|country=France|city=Paris|year=2020|month=5|day=20|time=23:59:59}

TAATTAAAGG GCCGTGGTAT A-CTGACCAT GCGAAGGTAG CATAATCATT AGCCTTTTGA TTTGAGGCTG

#pathogen_sample_20200610_Canberra_{population=european|group=asymptomatic|species=homo_sapiens|continent=Australia|country=Australia|city=Canberra|year=2020|month=6|day=10|time=13:59:59}

GTG..G.... ....C..... TTT.....G. .......... .......... ..T.....A. ..GA.....C

#pathogen_sample_20180402_Sydney_{population=european|group=asymptomatic|species=felis_catus|continent=Australia|country=Australia|city=Sydney|year=2018|month=4|day=2|time=22:58:00}

AT...G.... ....C..... TT......G. .......... .......... ..T.....A. ..G......C

In the following, we show an example in which human and mouse are designated as the members of the group Mammal and chicken belongs to group Aves.

!Gene A gene is a collection of domains. The domains included in a gene need not be consecutive or of the same type. Genes and domains can be defined in the input data, and can be defined and edited in the Setup Genes and Domains dialog. Genes can be selected or unselected from an analysis. When a gene is unselected, all its domains are automatically unselected. However, a gene can be selected, with some of its domains unselected.=FirstGene Domain=Exon1 Property=Coding;

#Human_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCTCAAT

#Mouse_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCCCAAT

#Chicken_{Aves} ATGGTTTCTAGTCAGCTCACCATGATAGGTCTCAAT

!Gene A gene is a collection of domains. The domains included in a gene need not be consecutive or of the same type. Genes and domains can be defined in the input data, and can be defined and edited in the Setup Genes and Domains dialog. Genes can be selected or unselected from an analysis. When a gene is unselected, all its domains are automatically unselected. However, a gene can be selected, with some of its domains unselected.=SecondGene Domain=Intron Introns are the non-coding segments of DNA in a gene that are interspersed among the exons. Property=Noncoding;

#Human ATTCCCAGGGAATTCCCGGGGGGTTTAAGGCCCCTTTAAAGAAAGAT

#Mouse GTAGCGCGCGTCGTCAGAGCTCCCAAGGGTAGCAGTCACAGAAAGAT

#Chicken GTAAAAAAAAAAGTCAGAGCTCCCCCCAATATATATCACAGAAAGAT

!Gene A gene is a collection of domains. The domains included in a gene need not be consecutive or of the same type. Genes and domains can be defined in the input data, and can be defined and edited in the Setup Genes and Domains dialog. Genes can be selected or unselected from an analysis. When a gene is unselected, all its domains are automatically unselected. However, a gene can be selected, with some of its domains unselected.=ThirdGene Domain=Exon2 Property=Coding;

#Human ATCTGCTCTCGAGTACTGATACAAATGACTTCTGCGTACAACTGA

#Mouse ATCTGATCTCGTGTGCTGGTACGAATGATTTCTGCGTTCAACTGA

#Chicken ATCTGCTCTCGAGTACTGCTACCAATGACTTCTGCGTACAACTGA